Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RBM33
CRISPR
in K562
Batch: BGKcLV48
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequenced
)
BGKcLV48-51
BGKcLV48-51
BGKcLV48-52
BGKcLV48-52
idx
0
0
0
0
TRCN#_or_BGC#
BGC#0001362
BGC#0001362
BGC#0001362
BGC#0001362
shRNA_or_gRNA_sequence
GGGCCCCGCGAGTGCCATGG
GGGCCCCGCGAGTGCCATGG
GGGCCCCGCGAGTGCCATGG
GGGCCCCGCGAGTGCCATGG
PAM
CGG
CGG
CGG
CGG
Name
RBM33_75
RBM33_75
RBM33_75
RBM33_75
Sample_ID
BGKcLV48-51
BGKcLV48-51
BGKcLV48-52
BGKcLV48-52
transduction_Date
4/15/25
4/15/25
4/15/25
4/15/25
days
D6
D6
D6
D6
RBP_name
RBM33
RBM33
RBM33
RBM33
qPCR_result
32.6
32.6
14.7
14.7
Ave_qPCR
23.7
23.7
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2096
2096
2111
2111
WB_result
86.9
62.6
85.8
57.5
Ave_WB
WB_DONE_date
5/8/25
5/28/25
MW
130KD
130KD
IP
antibody_Cat#
A303-926A
A303-927A
LOT #1
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
0
0
Rep2_TPM
0
0
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
6185
6187
6186
6188
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
RBM33
Product_ID:
A303-926A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RBM33-human
RBM33
Product_ID:
A303-927A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RBM33-human
Experiment Status
BGKcLV48-51
BGKcLV48-51
BGKcLV48-52
BGKcLV48-52
Sample_ID
BGKcLV48-51
BGKcLV48-51
BGKcLV48-52
BGKcLV48-52
Sample Name
Sample Name
RBM33-BGKcLV48-51
RBM33-BGKcLV48-52
RBP
RBM33
RBM33
RBM33
RBM33
Cell_Line
K562
K562
K562
K562
Exp UID
Status
Sequenced
NotSatisfied
Sequenced
NotSatisfied
Status_date
2025-10-02
2025-08-06
2025-10-02
2025-08-06
Project
ENCORE2
ENCORE2
ENCORE2
ENCORE2
Note
ID
14248
14300
14249
14301
Library-Prep
Sequencing
Library-Prep Information
BGKcLV48-51
BGKcLV48-52
Sample #
11
12
Sample Name
RBM33-BGKcLV48-51
RBM33-BGKcLV48-52
Sample_Name_Alias
Index Well Position
C02
D02
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-08-18
2025-08-18
Lib_ID
Lib-250818
Lib-250818
Tecan_Location
Tecan
Tecan_date
Size_bp
279
268
Peak_Molarity
98.00
114.00
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-08-19
2025-08-19
Sample_ID
BGKcLV48-51
BGKcLV48-52
RBP
RBM33
RBM33
Batch_ID
BGKcLV48
BGKcLV48
WB_result
86.900
85.800
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4756
4757
Sequencing Information
BGKcLV48-51
BGKcLV48-52
Sample_ID
BGKcLV48-51
BGKcLV48-52
Sample Name
RBM33-BGKcLV48-51
RBM33-BGKcLV48-52
Pool ID
Pool-250822
Pool-250822
LocalServer_folder
total_reads
0
0
total_aligned_reads
0
0
unique_aligned_reads
0
0
percent_uniqueAligned
correlation_replicates
spikein_reads
0
0
percent_spikeins
original_ReadLength
QC_Status
ReadyToQC
ReadyToQC
ID
3459
3460
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back