Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RUVBL2
CRISPR
in K562
Control:
NT-BGKcLV46-1,NT-BGKcLV46-2
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
RUVBL2
Cell_Line
K562
Method
CRISPR
Exp_Name
RUVBL2-BGKcLV46-K562
ENCODE_series_ID
Batch_ID
BGKcLV46
Pool ID
Pool-250312
Local_Set_Name
set77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1
RUVBL2-BGKcLV46-87
Rep2
RUVBL2-BGKcLV46-88
CN1
NT-BGKcLV46-1
CN2
NT-BGKcLV46-2
Rep1_qPCR
xx
Rep2_qPCR
xx
Rep1_WB
83.3
Rep2_WB
86.7
Antibody Cat#
A302-536A
Antibody Lot#
lot# 1
Antibody DCC ID
Status
Submitted
Project
ENCORE2
ID
1653
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV46-85
BGKcLV46-86
idx
0
0
TRCN#_or_BGC#
BGC#0001102
BGC#0001102
shRNA_or_gRNA_sequence
GGGAAGGGAAGATTGCCGGT
GGGAAGGGAAGATTGCCGGT
PAM
CGG
CGG
Name
RUVBL2_85
RUVBL2_85
Sample_ID
BGKcLV46-85
BGKcLV46-86
transduction_Date
12/20/24
12/20/24
days
D6
D6
RBP_name
RUVBL2
RUVBL2
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4927
5564
WB_result
61.4
63.0
Ave_WB
WB_DONE_date
1/15/25
MW
51kd
actin
IP
antibody_Cat#
A302-536A
lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
6098
6099
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV46-85
BGKcLV46-86
Sample_ID
BGKcLV46-85
BGKcLV46-86
Sample Name
Sample Name
RBP
RUVBL2
RUVBL2
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-02-10
2025-02-10
Project
ENCORE2
ENCORE2
Note
ID
14120
14121
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back