EIF3K      CRISPR in K562      Control: NT-BGKcLV46-1,NT-BGKcLV46-2

General Information
RBPEIF3K
Cell_LineK562
MethodCRISPR
Exp_NameEIF3K-BGKcLV46-K562
ENCODE_series_ID
Batch_IDBGKcLV46
Pool IDPool-250312
Local_Set_Nameset77
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1EIF3K-BGKcLV46-31
Rep2EIF3K-BGKcLV46-32
CN1NT-BGKcLV46-1
CN2NT-BGKcLV46-2
Rep1_qPCR83.5
Rep2_qPCR81.5
Rep1_WB69.5
Rep2_WB87.1
Antibody Cat#A301-763A
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1640




Experiment Information (Status: Submitting)
BGKcLV46-31BGKcLV46-32
idx00
TRCN#_or_BGC#BGC#0000972BGC#0000972
shRNA_or_gRNA_sequenceGTGCAAGTGCATGATCGACCGTGCAAGTGCATGATCGACC
PAMAGGAGG
NameEIF3K_96EIF3K_96
Sample_IDBGKcLV46-31BGKcLV46-32
transduction_Date12/20/2412/20/24
daysD6D6
RBP_nameEIF3KEIF3K
qPCR_result83.581.5
Ave_qPCR82.5
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc38983674
WB_result69.587.1
Ave_WB
WB_DONE_date12/31/24
MW25kd
IP
antibody_Cat#A301-763Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID60386039




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
EIF3KProduct_ID: A301-763A
Lot_ID: 1
Source: Bethyl Labs
Target Name: EIF3K-human
EIF3K-HEPG2-CRISPR-A301-763A.png<br>Caption: Western blot following CRISPR against EIF3K in HepG2 whole cell lysate using EIF3K specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF3K. EIF3K protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
EIF3K-K562-CRISPR-A301-763A.png<br>Caption: Western blot following CRISPR against EIF3K in K562 whole cell lysate using EIF3K specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF3K. EIF3K protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV46-31BGKcLV46-32
Sample_IDBGKcLV46-31BGKcLV46-32
Sample Name
Sample NameEIF3K-BGKcLV46-31EIF3K-BGKcLV46-32
RBPEIF3KEIF3K
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-04-212025-04-21
ProjectENCORE2ENCORE2
Note
ID1403414035




Library-Prep Information
BGKcLV46-31BGKcLV46-32
Sample #1314
Sample NameEIF3K-BGKcLV46-31EIF3K-BGKcLV46-32
Sample_Name_Alias
Index Well PositionE02F02
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-02-202025-02-20
Lib_IDLib-250220Lib-250220
Tecan_Location
Tecan
Tecan_date
Size_bp303333
Peak_Molarity92.1046.40
libSampleQC_DNA_WellDNA_Library_set77/set1/E8.pngDNA_Library_set77/set1/F8.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set77/set1/E2.pngRNA_Library_set77/set1/F2.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-02-282025-02-28
Sample_IDBGKcLV46-31BGKcLV46-32
RBPEIF3KEIF3K
Batch_IDBGKcLV46BGKcLV46
WB_result69.50087.100
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID46724673




Sequencing Information
BGKcLV46-31BGKcLV46-32
Sample_IDBGKcLV46-31BGKcLV46-32
Sample NameEIF3K-BGKcLV46-31EIF3K-BGKcLV46-32
Pool IDPool-250312Pool-250312
LocalServer_folderset77set77
total_reads56,515,40367,347,202
total_aligned_reads52,356,11163,405,581
unique_aligned_reads48,248,79658,539,135
percent_uniqueAligned0.853730.86921
correlation_replicates0.9978630.997863
spikein_reads85,710144,196
percent_spikeins0.001520.00214
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID33773378




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
EIF3K-BGKcLV46-31_S13_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set77/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3377NovaSeq6000100paired-ended1NT-BGKcLV46-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV46-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE232158
EIF3K-BGKcLV46-31_S13_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set77/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3377NovaSeq6000100paired-ended2NT-BGKcLV46-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV46-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232208
EIF3K-BGKcLV46-31_Aligned.sortedByCoord.out.bamENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_S13_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF3K-BGKcLV46-31_S13_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232258
EIF3K-BGKcLV46-31_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_Aligned.sortedByCoord.out.bamENCORE232308
EIF3K-BGKcLV46-31_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_Aligned.sortedByCoord.out.bamENCORE232358
EIF3K-BGKcLV46-31_Signal.Unique.strand-.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_Aligned.sortedByCoord.out.bamENCORE232408
EIF3K-BGKcLV46-31_Signal.Unique.strand+.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_Aligned.sortedByCoord.out.bamENCORE232458
EIF3K-BGKcLV46-31_quant.sfENCODE_DATA/set77/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3377GRCh38V40EIF3K-BGKcLV46-31_S13_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF3K-BGKcLV46-31_S13_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232508
EIF3K-BGKcLV46-32_S14_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set77/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3378NovaSeq6000100paired-ended1NT-BGKcLV46-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV46-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE232159
EIF3K-BGKcLV46-32_S14_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set77/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3378NovaSeq6000100paired-ended2NT-BGKcLV46-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV46-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232209
EIF3K-BGKcLV46-32_Aligned.sortedByCoord.out.bamENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_S14_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF3K-BGKcLV46-32_S14_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232259
EIF3K-BGKcLV46-32_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_Aligned.sortedByCoord.out.bamENCORE232309
EIF3K-BGKcLV46-32_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_Aligned.sortedByCoord.out.bamENCORE232359
EIF3K-BGKcLV46-32_Signal.Unique.strand-.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_Aligned.sortedByCoord.out.bamENCORE232409
EIF3K-BGKcLV46-32_Signal.Unique.strand+.bwENCODE_DATA/set77/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_Aligned.sortedByCoord.out.bamENCORE232459
EIF3K-BGKcLV46-32_quant.sfENCODE_DATA/set77/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3378GRCh38V40EIF3K-BGKcLV46-32_S14_L001_R1_001.filtered.trimmed.paired.fastq.gz,EIF3K-BGKcLV46-32_S14_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE232509