Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
UBAP2L
CRISPR
in K562
Batch: BGKcLV46
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV46-109
BGKcLV46-110
idx
0
0
TRCN#_or_BGC#
BGC#0001069
BGC#0001069
shRNA_or_gRNA_sequence
ATAAGCACTCTACCGTGTCT
ATAAGCACTCTACCGTGTCT
PAM
GGG
GGG
Name
UBAP2L_94B
UBAP2L_94B
Sample_ID
BGKcLV46-109
BGKcLV46-110
transduction_Date
12/20/24
12/20/24
days
D6
D6
RBP_name
UBAP2L
UBAP2L
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4548
4736
WB_result
Ave_WB
WB_DONE_date
1/15/25
MW
115kd
150,160KD
IP
antibody_Cat#
40199S
lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
6128
6129
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV46-109
BGKcLV46-110
Sample_ID
BGKcLV46-109
BGKcLV46-110
Sample Name
Sample Name
RBP
UBAP2L
UBAP2L
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2025-02-10
2025-02-10
Project
ENCORE2
ENCORE2
Note
ID
14140
14141
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back