Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
IGF2BP1
CRISPR
in K562
Batch: BGKcLV44
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV44-101
BGKcLV44-102
idx
0
0
TRCN#_or_BGC#
BGC#0000002
BGC#0000002
shRNA_or_gRNA_sequence
CAAATCCGGCTACGCCTTCG
CAAATCCGGCTACGCCTTCG
PAM
tgg
tgg
Name
IGF2BP1-C2-A
IGF2BP1-C2-A
Sample_ID
BGKcLV44-101
BGKcLV44-102
transduction_Date
7/30/24
7/30/24
days
D6
D6
RBP_name
IGF2BP1
IGF2BP1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
acagcctgctggctcagtat
RT-qPCR_primer-R
ccggttggaataggtgacat
protein_conc
3952
4066
WB_result
54.6
59.0
Ave_WB
54.6
WB_DONE_date
8/28/24
FOR wb
MW
63kDa
IP
antibody_Cat#
8482S
lot # 2
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5997
5998
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV44-101
BGKcLV44-102
Sample_ID
BGKcLV44-101
BGKcLV44-102
Sample Name
Sample Name
RBP
IGF2BP1
IGF2BP1
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2024-10-08
2024-10-08
Project
ENCORE2
ENCORE2
Note
ID
13684
13685
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back