DDX41      CRISPR in K562      Batch: BGKcLV40

Experiment Information (Status: NotSatisfied)
BGKcLV40-5BGKcLV40-6
idx14881489
TRCN#_or_BGC#BGC#0000897BGC#0000897
shRNA_or_gRNA_sequenceCTGAATCTTCTTCGGCATGGCTGAATCTTCTTCGGCATGG
PAMtggtgg
NameDDX41_87DDX41_87
Sample_IDBGKcLV40-5BGKcLV40-6
transduction_Date10/31/2310/31/23
daysD6D6
RBP_nameDDX41DDX41
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc30393699
WB_result0.00.0
Ave_WB0.0
WB_DONE_date11/8/23
MW70KD
IP
antibody_Cat#A301-050Alot # 2
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID56855686




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV40-5BGKcLV40-6
Sample_IDBGKcLV40-5BGKcLV40-6
Sample Name
Sample Name
RBPDDX41DDX41
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-12-152023-12-15
ProjectENCORE2ENCORE2
Note
ID1279812799




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database