EIF3M      CRISPR in K562      Control: NT-BGKcLV38-1,NT-BGKcLV38-2

General Information
RBPEIF3M
Cell_LineK562
MethodCRISPR
Exp_NameEIF3M-BGKcLV38-K562
ENCODE_series_ID
Batch_IDBGKcLV38
Pool IDPool-230127C
Local_Set_Nameset56
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1EIF3M-BGKcLV38-57
Rep2EIF3M-BGKcLV38-58
CN1NT-BGKcLV38-1
CN2NT-BGKcLV38-2
Rep1_qPCR11.7
Rep2_qPCR24.2
Rep1_WB53.3
Rep2_WB50.6
Antibody Cat#A304-761A
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1039




Experiment Information (Status: Submitting)
BGKcLV38-57BGKcLV38-58
idx14741475
TRCN#_or_BGC#BGC#0000977BGC#0000977
shRNA_or_gRNA_sequenceTTCTTCACTGATGTCGATGATTCTTCACTGATGTCGATGA
PAMAGGAGG
NameEIF3M_86EIF3M_86
Sample_IDBGKcLV38-57BGKcLV38-58
transduction_Date10/18/2210/18/22
daysD6D6
RBP_nameEIF3MEIF3M
qPCR_result11.724.2
Ave_qPCR18.0
RT-qPCR_primer-Fgcagcaagaacttcagattgg
RT-qPCR_primer-Rtctgggtctgatcaattttgc
protein_conc33303224
WB_result53.350.6
Ave_WB51.9
WB_DONE_date11/4/22
MW43KD
IP
antibody_Cat#A304-761Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID56715672




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
EIF3MProduct_ID: A304-761A
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: EIF3M-human
EIF3M-HEPG2-CRISPR-A304-761A.png<br>Caption: Western blot following CRISPR against EIF3M in HepG2 whole cell lysate using EIF3M specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF3M. EIF3M protein appears as the green arrow, Tubulin serves as a control and appears in red arrow.
EIF3M-K562-CRISPR-A304-761A.png<br>Caption: Western blot following CRISPR against EIF3M in K562 whole cell lysate using EIF3M specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against EIF3M. EIF3M protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV38-57BGKcLV38-58
Sample_IDBGKcLV38-57BGKcLV38-58
Sample Name
Sample NameEIF3M-BGKcLV38-57EIF3M-BGKcLV38-58
RBPEIF3MEIF3M
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2023-04-142023-04-14
ProjectENCORE2ENCORE2
Note
ID1105211053




Library-Prep Information
BGKcLV38-57BGKcLV38-58
Sample #8788
Sample NameEIF3M-BGKcLV38-57EIF3M-BGKcLV38-58
Sample_Name_Alias
Index Well PositionE12F12
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2023-01-192023-01-19
Lib_IDLib-230119Lib-230119
Tecan_Location
Tecan
Tecan_date
Size_bp292292
Peak_Molarity50.5067.90
libSampleQC_DNA_WellDNA_Library_set54-56/set2/E12.pngDNA_Library_set54-56/set2/F12.png
RIN9.99.8
libSample_RNA_WellRNA_Library_set54-56/set1/G11.pngRNA_Library_set54-56/set1/H11.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2023-01-272023-01-27
Sample_IDBGKcLV38-57BGKcLV38-58
RBPEIF3MEIF3M
Batch_IDBGKcLV38BGKcLV38
WB_result53.30050.600
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID34583459




Sequencing Information
BGKcLV38-57BGKcLV38-58
Sample_IDBGKcLV38-57BGKcLV38-58
Sample NameEIF3M-BGKcLV38-57EIF3M-BGKcLV38-58
Pool IDPool-230127CPool-230127C
LocalServer_folderset56set56
total_reads46,789,34273,595,480
total_aligned_reads43,629,10270,074,309
unique_aligned_reads40,530,30565,024,780
percent_uniqueAligned0.866230.88354
correlation_replicates0.9980340.998034
spikein_reads4,64610,282
percent_spikeins0.000100.00014
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID23292330




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
EIF3M-BGKcLV38-57_S85_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2329NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28334
EIF3M-BGKcLV38-57_S85_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2329NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28372
EIF3M-BGKcLV38-57_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57_S85_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF3M-BGKcLV38-57_S85_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216986
EIF3M-BGKcLV38-57_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57/Aligned.sortedByCoord.out.bamENCORE217024
EIF3M-BGKcLV38-57_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57/Aligned.sortedByCoord.out.bamENCORE217062
EIF3M-BGKcLV38-57_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57/Aligned.sortedByCoord.out.bamENCORE217100
EIF3M-BGKcLV38-57_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57/Aligned.sortedByCoord.out.bamENCORE217138
EIF3M-BGKcLV38-57_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2329GRCh38V40EIF3M-BGKcLV38-57_S85_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF3M-BGKcLV38-57_S85_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217176
EIF3M-BGKcLV38-58_S86_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2330NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28335
EIF3M-BGKcLV38-58_S86_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2330NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28373
EIF3M-BGKcLV38-58_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58_S86_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF3M-BGKcLV38-58_S86_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216987
EIF3M-BGKcLV38-58_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58/Aligned.sortedByCoord.out.bamENCORE217025
EIF3M-BGKcLV38-58_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58/Aligned.sortedByCoord.out.bamENCORE217063
EIF3M-BGKcLV38-58_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58/Aligned.sortedByCoord.out.bamENCORE217101
EIF3M-BGKcLV38-58_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58/Aligned.sortedByCoord.out.bamENCORE217139
EIF3M-BGKcLV38-58_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2330GRCh38V40EIF3M-BGKcLV38-58_S86_L002_R1_001.filtered.trimmed.paired.fastq.gz,EIF3M-BGKcLV38-58_S86_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217177