DNAJC2      CRISPR in K562      Control: NT-BGKcLV38-1,NT-BGKcLV38-2

General Information
RBPDNAJC2
Cell_LineK562
MethodCRISPR
Exp_NameDNAJC2-BGKcLV38-K562
ENCODE_series_ID
Batch_IDBGKcLV38
Pool IDPool-230127C
Local_Set_Nameset56
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1DNAJC2-BGKcLV38-21
Rep2DNAJC2-BGKcLV38-22
CN1NT-BGKcLV38-1
CN2NT-BGKcLV38-2
Rep1_qPCR56.4
Rep2_qPCR45.8
Rep1_WB71.0
Rep2_WB79.7
Antibody Cat#A303-722A
Antibody Lot#lot# 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1027




Experiment Information (Status: Submitting)
BGKcLV38-21BGKcLV38-21BGKcLV38-22BGKcLV38-22
idx1438014390
TRCN#_or_BGC#BGC#0000936BGC#0000936BGC#0000936BGC#0000936
shRNA_or_gRNA_sequenceAGAAGCTGCTCGGTTAGCTAAGAAGCTGCTCGGTTAGCTAAGAAGCTGCTCGGTTAGCTAAGAAGCTGCTCGGTTAGCTA
PAMAGGAGGAGGAGG
NameDNAJC2_94DNAJC2_94DNAJC2_94DNAJC2_94
Sample_IDBGKcLV38-21BGKcLV38-21BGKcLV38-22BGKcLV38-22
transduction_Date10/18/2210/18/2210/18/2210/18/22
daysD6D6D6D6
RBP_nameDNAJC2DNAJC2DNAJC2DNAJC2
qPCR_result56.456.445.845.8
Ave_qPCR51.151.1
RT-qPCR_primer-Fgaagctaaacggaaggagcagaagctaaacggaaggagca
RT-qPCR_primer-Rgcaatgcttgctgtctgactgcaatgcttgctgtctgact
protein_conc3621362134773477
WB_result71.069.779.763.9766
Ave_WB75.4
WB_DONE_date10/26/222/29/24
MW72KD72KD
IP
antibody_Cat#A303-722A12844Slot# 1lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM0000
Rep2_TPM0000
ActionReadyReady
Library_start_date
repeat_library
Note
ID5621562356225624




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
DNAJC2Product_ID: A303-722A
Lot_ID: 1
Source: Bethyl Labs
Target Name: DNAJC2-human
DNAJC2-K562-CRISPR-A303-722A.png<br>Caption: Western blot following CRISPR against DNAJC2 in K562 whole cell lysate using DNAJC2 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DNAJC2. DNAJC2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
DNAJC2Product_ID: 12844S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: DNAJC2-human
CST_12844S_1_DNAJC2.png<br>Caption: IP-WB analysis of 12844S whole cell lysate using the DNAJC2 specific antibody, 12844S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the DNAJC2-specific antibody, 12844S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
DNAJC2-K562-CRISPR-12844S.png<br>Caption: Western blot following CRISPR against DNAJC2 in K562 whole cell lysate using DNAJC2 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DNAJC2. DNAJC2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV38-21BGKcLV38-22
Sample_IDBGKcLV38-21BGKcLV38-22
Sample Name
Sample NameDNAJC2-BGKcLV38-21DNAJC2-BGKcLV38-22
RBPDNAJC2DNAJC2
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2023-04-142023-04-14
ProjectENCORE2ENCORE2
Note
ID1102811029




Library-Prep Information
BGKcLV38-21BGKcLV38-22
Sample #6364
Sample NameDNAJC2-BGKcLV38-21DNAJC2-BGKcLV38-22
Sample_Name_Alias
Index Well PositionE09F09
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2023-01-192023-01-19
Lib_IDLib-230119Lib-230119
Tecan_Location
Tecan
Tecan_date
Size_bp294296
Peak_Molarity63.8074.40
libSampleQC_DNA_WellDNA_Library_set54-56/set2/E9.pngDNA_Library_set54-56/set2/F9.png
RIN9.89.7
libSample_RNA_WellRNA_Library_set54-56/set1/G8.pngRNA_Library_set54-56/set1/H8.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2023-01-272023-01-27
Sample_IDBGKcLV38-21BGKcLV38-22
RBPDNAJC2DNAJC2
Batch_IDBGKcLV38BGKcLV38
WB_result71.00079.700
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID34343435




Sequencing Information
BGKcLV38-21BGKcLV38-22
Sample_IDBGKcLV38-21BGKcLV38-22
Sample NameDNAJC2-BGKcLV38-21DNAJC2-BGKcLV38-22
Pool IDPool-230127CPool-230127C
LocalServer_folderset56set56
total_reads89,307,72161,515,753
total_aligned_reads81,782,03556,544,327
unique_aligned_reads76,117,17952,492,210
percent_uniqueAligned0.852300.85331
correlation_replicates0.9968590.996859
spikein_reads11,54010,106
percent_spikeins0.000130.00016
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID23052306




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
DNAJC2-BGKcLV38-21_S61_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2305NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28310
DNAJC2-BGKcLV38-21_S61_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2305NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28348
DNAJC2-BGKcLV38-21_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21_S61_L002_R1_001.filtered.trimmed.paired.fastq.gz,DNAJC2-BGKcLV38-21_S61_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216962
DNAJC2-BGKcLV38-21_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21/Aligned.sortedByCoord.out.bamENCORE217000
DNAJC2-BGKcLV38-21_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21/Aligned.sortedByCoord.out.bamENCORE217038
DNAJC2-BGKcLV38-21_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21/Aligned.sortedByCoord.out.bamENCORE217076
DNAJC2-BGKcLV38-21_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21/Aligned.sortedByCoord.out.bamENCORE217114
DNAJC2-BGKcLV38-21_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2305GRCh38V40DNAJC2-BGKcLV38-21_S61_L002_R1_001.filtered.trimmed.paired.fastq.gz,DNAJC2-BGKcLV38-21_S61_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217152
DNAJC2-BGKcLV38-22_S62_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2306NovaSeq6000100paired-ended1NT-BGKcLV38-1_S51_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R1_001.filtered.trimmed.paired.fastq.gzENCORE28311
DNAJC2-BGKcLV38-22_S62_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set56/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2306NovaSeq6000100paired-ended2NT-BGKcLV38-1_S51_L002_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV38-2_S52_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE28349
DNAJC2-BGKcLV38-22_Aligned.sortedByCoord.out.bamENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22_S62_L002_R1_001.filtered.trimmed.paired.fastq.gz,DNAJC2-BGKcLV38-22_S62_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE216963
DNAJC2-BGKcLV38-22_Signal.Unique.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22/Aligned.sortedByCoord.out.bamENCORE217001
DNAJC2-BGKcLV38-22_Signal.Unique.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22/Aligned.sortedByCoord.out.bamENCORE217039
DNAJC2-BGKcLV38-22_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22/Aligned.sortedByCoord.out.bamENCORE217077
DNAJC2-BGKcLV38-22_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set56/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22/Aligned.sortedByCoord.out.bamENCORE217115
DNAJC2-BGKcLV38-22_quant.sfENCODE_DATA/set56/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2306GRCh38V40DNAJC2-BGKcLV38-22_S62_L002_R1_001.filtered.trimmed.paired.fastq.gz,DNAJC2-BGKcLV38-22_S62_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE217153