DDX41      CRISPR in K562      Batch: BGKcLV37

Experiment Information (Status: NotSatisfied)
BGKcLV37-7BGKcLV37-8
idx13591360
TRCN#_or_BGC#BGC#0000898BGC#0000898
shRNA_or_gRNA_sequenceAAGAGCGACATGAGCGCGTGAAGAGCGACATGAGCGCGTG
PAMcggcgg
NameDDX41_96DDX41_96
Sample_IDBGKcLV37-7BGKcLV37-8
transduction_Date9/20/229/20/22
daysD6D6
RBP_nameDDX41DDX41
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc18651656
WB_result48.938.1
Ave_WB43.5
WB_DONE_date9/28/22,9/29/22,10/1JESS, Licor
MW70KD
IP
antibody_Cat#A301-050A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID55205521




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV37-7BGKcLV37-8
Sample_IDBGKcLV37-7BGKcLV37-8
Sample Name
Sample Name
RBPDDX41DDX41
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1111611117




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database