YTHDC1      CRISPR in K562      Batch: BGKcLV37

Experiment Information (Status: NotSatisfied)
BGKcLV37-63BGKcLV37-64
idx14151416
TRCN#_or_BGC#BGC#0001079BGC#0001079
shRNA_or_gRNA_sequenceAGGATCCCTTTTCCGGACACAGGATCCCTTTTCCGGACAC
PAMAGGAGG
NameYTHDC1_93YTHDC1_93
Sample_IDBGKcLV37-63BGKcLV37-64
transduction_Date9/20/229/20/22
daysD6D6
RBP_nameYTHDC1YTHDC1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc18081691
WB_result0.00.0
Ave_WB
WB_DONE_date10/12/22too many bands
MW85kd
IP
antibody_Cat#A305-096Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID55905591




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV37-63BGKcLV37-64
Sample_IDBGKcLV37-63BGKcLV37-64
Sample Name
Sample Name
RBPYTHDC1YTHDC1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1115211153




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database