SUPT5H      CRISPR in K562      Batch: BGKcLV37

Experiment Information (Status: NotSatisfied)
BGKcLV37-49BGKcLV37-50
idx14011402
TRCN#_or_BGC#BGC#0001065BGC#0001065
shRNA_or_gRNA_sequenceGCGGAAGATGTCGGACAGCGGCGGAAGATGTCGGACAGCG
PAMAGGAGG
NameSUPT5H_92SUPT5H_92
Sample_IDBGKcLV37-49BGKcLV37-50
transduction_Date9/20/229/20/22
daysD6D6
RBP_nameSUPT5HSUPT5H
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc17501707
WB_result0.00.0
Ave_WB0.0
WB_DONE_date9/27/22Licor
MW121kd
IP
antibody_Cat#A300-868Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID55725573




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV37-49BGKcLV37-50
Sample_IDBGKcLV37-49BGKcLV37-50
Sample Name
Sample Name
RBPSUPT5HSUPT5H
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2023-01-032023-01-03
ProjectENCORE2ENCORE2
Note
ID1114011141




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database