CCDC47      CRISPR in K562      Control: NT-BGKcLV35-1,NT-BGKcLV35-2

General Information
RBPCCDC47
Cell_LineK562
MethodCRISPR
Exp_NameCCDC47-BGKcLV35-K562
ENCODE_series_ID
Batch_IDBGKcLV35
Pool IDPool-220720
Local_Set_Nameset54
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1CCDC47-BGKcLV35-9
Rep2CCDC47-BGKcLV35-10
CN1NT-BGKcLV35-1
CN2NT-BGKcLV35-2
Rep1_qPCR29.6
Rep2_qPCR39.7
Rep1_WB50.6
Rep2_WB58.7
Antibody Cat#A305-100A
Antibody Lot#LOT# 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID953




Experiment Information (Status: Submitting)
BGKcLV35-9BGKcLV35-9BGKcLV35-10BGKcLV35-10
idx1286128612871287
TRCN#_or_BGC#BGC#0000671BGC#0000671BGC#0000671BGC#0000671
shRNA_or_gRNA_sequenceAGCAGCACAGTCTCGGCGGGAGCAGCACAGTCTCGGCGGGAGCAGCACAGTCTCGGCGGGAGCAGCACAGTCTCGGCGGG
PAMAGGAGGAGGAGG
NameCCDC47_88/LAST EXONCCDC47_88/LAST EXONCCDC47_88/LAST EXONCCDC47_88/LAST EXON
Sample_IDBGKcLV35-9BGKcLV35-9BGKcLV35-10BGKcLV35-10
transduction_Date4/28/224/28/224/28/224/28/22
daysD6D6D6D6
RBP_nameCCDC47CCDC47CCDC47CCDC47
qPCR_result29.629.639.739.7
Ave_qPCR34.734.7
RT-qPCR_primer-Ftacccctgatgaacatggtgtacccctgatgaacatggtg
RT-qPCR_primer-Rctactcgggcacggttcttactactcgggcacggttctta
protein_conc3610361029122912
WB_result49.946.752.60343.9
Ave_WB51.3
WB_DONE_date6/2/227/15/25
MW56kDa56kDa
IPRabbit / I
antibody_Cat#A305-100AA305-101ALOT# 1LOT# 1
Antibody DCC IDENCAB491CRC12/5/24
submitted_to_DCC_date
Rep1_TPM0000
Rep2_TPM0000
ActionReadyReady
Library_start_date06/17/2206/17/22
repeat_library
Note
ID5437543954385440




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
CCDC47Product_ID: A305-100A
Lot_ID: 1
Source: Bethyl Labs
Target Name: CCDC47-human
Bethyl_A305-100A_1_CCDC47.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the CCDC47 specific antibody, A305-100A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the CCDC47-specific antibody, A305-100A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
CCDC47-K562-A305-100A.png<br>Caption: Western blot following CRISPR against CCDC47 in K562 whole cell lysate using CCDC47 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CCDC47. CCDC47 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CCDC47Product_ID: A305-101A
Lot_ID: 1
Source: Bethyl Labs
Target Name: CCDC47-human
CCDC47-HEPG2-CRISPR-A305-101A.png<br>Caption: Western blot following CRISPR against CCDC47 in HepG2 whole cell lysate using CCDC47 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CCDC47. CCDC47 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
Bethyl_A305-101A_1_CCDC47.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the CCDC47 specific antibody, A305-101A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the CCDC47-specific antibody, A305-101A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
CCDC47-K562-CRISPR-A305-101A.png<br>Caption: Western blot following CRISPR against CCDC47 in K562 whole cell lysate using CCDC47 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CCDC47. CCDC47 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV35-9BGKcLV35-10
Sample_IDBGKcLV35-9BGKcLV35-10
Sample Name
Sample NameCCDC47-BGKcLV35-9CCDC47-BGKcLV35-10
RBPCCDC47CCDC47
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2023-04-142023-04-14
ProjectENCORE2ENCORE2
Note
ID1086310864




Library-Prep Information
BGKcLV35-9BGKcLV35-10
Sample #2930
Sample NameCCDC47-BGKcLV35-9CCDC47-BGKcLV35-10
Sample_Name_Alias
Index Well PositionE04F04
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2022-06-172022-06-17
Lib_IDLib-220617Lib-220617
Tecan_Location
Tecan
Tecan_date
Size_bp282292
Peak_Molarity34.5013.40
libSampleQC_DNA_WellDNA_Library_set54-56/set3/E8.pngDNA_Library_set54-56/set3/F8.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set54-56/set2/E4.pngRNA_Library_set54-56/set2/F4.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2022-06-202022-06-20
Sample_IDBGKcLV35-9BGKcLV35-10
RBPCCDC47CCDC47
Batch_IDBGKcLV35BGKcLV35
WB_result50.60058.700
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID33463347




Sequencing Information
BGKcLV35-9BGKcLV35-10
Sample_IDBGKcLV35-9BGKcLV35-10
Sample NameCCDC47-BGKcLV35-9CCDC47-BGKcLV35-10
Pool IDPool-220720Pool-220720
LocalServer_folderset54set54
total_reads75,222,24052,451,504
total_aligned_reads68,885,92247,362,828
unique_aligned_reads63,052,08043,398,884
percent_uniqueAligned0.838210.82741
correlation_replicates0.9836030.983603
spikein_reads3,6344,296
percent_spikeins0.000050.00008
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID22252226




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
CCDC47-BGKcLV35-9_S31_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set54/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2225NovaSeq6000100paired-ended1NT-BGKcLV35-1_S25_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV35-2_S26_R1_001.filtered.trimmed.paired.fastq.gzENCORE28483
CCDC47-BGKcLV35-9_S31_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set54/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2225NovaSeq6000100paired-ended2NT-BGKcLV35-1_S25_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV35-2_S26_R2_001.filtered.trimmed.paired.fastq.gzENCORE28533
CCDC47-BGKcLV35-9_Signal.Unique.strand+.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9/Aligned.sortedByCoord.out.bamENCORE217729
CCDC47-BGKcLV35-9_Signal.Unique.strand-.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9/Aligned.sortedByCoord.out.bamENCORE217779
CCDC47-BGKcLV35-9_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9/Aligned.sortedByCoord.out.bamENCORE217829
CCDC47-BGKcLV35-9_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9/Aligned.sortedByCoord.out.bamENCORE217879
CCDC47-BGKcLV35-9_quant.sfENCODE_DATA/set54/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9_S31_R1_001.filtered.trimmed.paired.fastq.gz,CCDC47-BGKcLV35-9_S31_R2_001.filtered.trimmed.paired.fastq.gzENCORE217929
CCDC47-BGKcLV35-9_Aligned.sortedByCoord.out.bamENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2225GRCh38V40CCDC47-BGKcLV35-9_S31_R1_001.filtered.trimmed.paired.fastq.gz,CCDC47-BGKcLV35-9_S31_R2_001.filtered.trimmed.paired.fastq.gzENCORE229270
CCDC47-BGKcLV35-10_S32_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set54/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2226NovaSeq6000100paired-ended1NT-BGKcLV35-1_S25_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV35-2_S26_R1_001.filtered.trimmed.paired.fastq.gzENCORE28482
CCDC47-BGKcLV35-10_S32_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set54/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2226NovaSeq6000100paired-ended2NT-BGKcLV35-1_S25_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV35-2_S26_R2_001.filtered.trimmed.paired.fastq.gzENCORE28532
CCDC47-BGKcLV35-10_Signal.Unique.strand+.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10/Aligned.sortedByCoord.out.bamENCORE217728
CCDC47-BGKcLV35-10_Signal.Unique.strand-.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10/Aligned.sortedByCoord.out.bamENCORE217778
CCDC47-BGKcLV35-10_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10/Aligned.sortedByCoord.out.bamENCORE217828
CCDC47-BGKcLV35-10_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10/Aligned.sortedByCoord.out.bamENCORE217878
CCDC47-BGKcLV35-10_quant.sfENCODE_DATA/set54/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10_S32_R1_001.filtered.trimmed.paired.fastq.gz,CCDC47-BGKcLV35-10_S32_R2_001.filtered.trimmed.paired.fastq.gzENCORE217928
CCDC47-BGKcLV35-10_Aligned.sortedByCoord.out.bamENCODE_DATA/set54/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2226GRCh38V40CCDC47-BGKcLV35-10_S32_R1_001.filtered.trimmed.paired.fastq.gz,CCDC47-BGKcLV35-10_S32_R2_001.filtered.trimmed.paired.fastq.gzENCORE229269