RPL8      CRISPR in K562      Batch: BGKcLV35

Experiment Information (Status: NotSatisfied)
BGKcLV35-47BGKcLV35-48
idx13241325
TRCN#_or_BGC#BGC#0000804BGC#0000804
shRNA_or_gRNA_sequenceGCGCCGTGGATTTCGCTGAGGCGCCGTGGATTTCGCTGAG
PAMCGGCGG
NameRPL8_95RPL8_95
Sample_IDBGKcLV35-47BGKcLV35-48
transduction_Date4/28/224/28/22
daysD6D6
RBP_nameRPL8RPL8
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc30343991
WB_result39.038.9
Ave_WB39.0
WB_DONE_date5/12/22
MW28KD
IP
antibody_Cat#A305-059ALOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID54835484




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV35-47BGKcLV35-48
Sample_IDBGKcLV35-47BGKcLV35-48
Sample Name
Sample Name
RBPRPL8RPL8
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2022-06-162022-06-16
ProjectENCORE2ENCORE2
Note
ID1090910910




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database