RUVBL2      CRISPR in K562      Batch: BGKcLV33

Experiment Information (Status: NotSatisfied)
BGKcLV33-19BGKcLV33-19BGKcLV33-20BGKcLV33-20
idx1121119811221199
TRCN#_or_BGC#BGC#0000838BGC#0000831BGC#0000838BGC#0000831
shRNA_or_gRNA_sequenceTTACTTGATGCGAACGCCGAGATTACGGGCCCAAGGCCCGTTACTTGATGCGAACGCCGAGATTACGGGCCCAAGGCCCG
PAMTGGCGGTGGCGG
NameRUVBL2_99RRP8_92RUVBL2_99RRP8_92
Sample_IDBGKcLV33-19BGKcLV33-19BGKcLV33-20BGKcLV33-20
transduction_Date12/7/212/22/2212/7/212/22/22
daysD6D6D6D6
RBP_nameRUVBL2RRP8RUVBL2RRP8
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc34223162812303
WB_result0.00.00.00.0
Ave_WB0.00.0
WB_DONE_date2/2223/2/22,3/7/22
MW51kd51KD
IP
antibody_Cat#A302-536AA304-202ALOT #1LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM0000
Rep2_TPM0000
Action
Library_start_date
repeat_library
Note
ID5268534552695346




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV33-19BGKcLV33-19BGKcLV33-20BGKcLV33-20
Sample_IDBGKcLV33-19BGKcLV33-19BGKcLV33-20BGKcLV33-20
Sample Name
Sample Name
RBPRUVBL2RRP8RUVBL2RRP8
Cell_LineK562K562K562K562
Exp UID
StatusNotSatisfiedNotSatisfiedNotSatisfiedNotSatisfied
Status_date2022-03-302022-03-302022-03-302022-03-30
ProjectENCODE4ENCODE4ENCODE4ENCODE4
Note
ID10705107651070610766




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database