Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPL8
CRISPR
in K562
Batch: BGKcLV30
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV30-57
BGKcLV30-58
idx
1086
1087
TRCN#_or_BGC#
BGC#0000805
BGC#0000805
shRNA_or_gRNA_sequence
TACGGTGCTTCACGTGCGCG
TACGGTGCTTCACGTGCGCG
PAM
CGG
CGG
Name
RPL8_97
RPL8_97
Sample_ID
BGKcLV30-57
BGKcLV30-58
transduction_Date
8/30/21
8/30/21
days
D6
D6
RBP_name
RPL8
RPL8
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2333
2422
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
9/30/21
LICOR
MW
28KD
IP
antibody_Cat#
A305-059A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5233
5234
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV30-57
BGKcLV30-58
Sample_ID
BGKcLV30-57
BGKcLV30-58
Sample Name
Sample Name
RBP
RPL8
RPL8
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2021-10-28
2021-10-28
Project
ENCODE4
ENCODE4
Note
ID
10115
10116
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back