RC3H1      CRISPR in K562      Batch: BGKcLV30

Experiment Information (Status: NotSatisfied)
BGKcLV30-25BGKcLV30-26
idx10501051
TRCN#_or_BGC#BGC#0000773BGC#0000773
shRNA_or_gRNA_sequenceGAGAGGAAATCCGTCCATTGGAGAGGAAATCCGTCCATTG
PAMTGGTGG
NameRC3H1_91RC3H1_91
Sample_IDBGKcLV30-25BGKcLV30-26
transduction_Date8/30/218/30/21
daysD6D6
RBP_nameRC3H1RC3H1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc22862261
WB_resulttoo many bands
Ave_WB
WB_DONE_date9/9/21,9/28/21JESS, LICOR
MW126KD
IP
antibody_Cat#A300-514ALOT #2
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID51955196




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV30-25BGKcLV30-26
Sample_IDBGKcLV30-25BGKcLV30-26
Sample Name
Sample Name
RBPRC3H1RC3H1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2021-10-282021-10-28
ProjectENCODE4ENCODE4
Note
ID1009510096




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database