CSDE1      CRISPR in K562      Batch: BGKcLV28

Experiment Information (Status: NotSatisfied)
BGKcLV28-41BGKcLV28-42
idx981982
TRCN#_or_BGC#BGC#0000718BGC#0000718
shRNA_or_gRNA_sequenceGTGAATTCCACATCATCGCCGTGAATTCCACATCATCGCC
PAMAGGAGG
NameCSDE1_91CSDE1_91
Sample_IDBGKcLV28-41BGKcLV28-42
transduction_Date7/12/217/12/21
daysDay 6Day 6
RBP_nameCSDE1CSDE1
qPCR_result
Ave_qPCR
RT-qPCR_primer-Ftgaatgacaaaatccgcaaa
RT-qPCR_primer-Rtgggaccaatgtcatcaaaa
protein_conc25292504
WB_result38.731.7
Ave_WB35.2
WB_DONE_date8/6/21,6/29/21,7/8/2JESS
MW52KD
IP
antibody_Cat#A303-158ALOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID51225123




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV28-41BGKcLV28-42
Sample_IDBGKcLV28-41BGKcLV28-42
Sample Name
Sample Name
RBPCSDE1CSDE1
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2021-09-162021-09-16
ProjectENCODE4ENCODE4
Note
ID99599960




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database