Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
CSDE1
CRISPR
in K562
Batch: BGKcLV28
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV28-41
BGKcLV28-42
idx
981
982
TRCN#_or_BGC#
BGC#0000718
BGC#0000718
shRNA_or_gRNA_sequence
GTGAATTCCACATCATCGCC
GTGAATTCCACATCATCGCC
PAM
AGG
AGG
Name
CSDE1_91
CSDE1_91
Sample_ID
BGKcLV28-41
BGKcLV28-42
transduction_Date
7/12/21
7/12/21
days
Day 6
Day 6
RBP_name
CSDE1
CSDE1
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
tgaatgacaaaatccgcaaa
RT-qPCR_primer-R
tgggaccaatgtcatcaaaa
protein_conc
2529
2504
WB_result
38.7
31.7
Ave_WB
35.2
WB_DONE_date
8/6/21,6/29/21,7/8/2
JESS
MW
52KD
IP
antibody_Cat#
A303-158A
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
5122
5123
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV28-41
BGKcLV28-42
Sample_ID
BGKcLV28-41
BGKcLV28-42
Sample Name
Sample Name
RBP
CSDE1
CSDE1
Cell_Line
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2021-09-16
2021-09-16
Project
ENCODE4
ENCODE4
Note
ID
9959
9960
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back